Điều hòa sự biểu hiện của gen

Trong một cơ thể đa bào

Tế bào được biểu hiện bởi các gen khác nhau

Mọi tế bào đều có cùng bản chất di truyền DNA

 

 

pptx70 trang | Chia sẻ: tieuaka001 | Ngày: 19/09/2020 | Lượt xem: 5 | Lượt tải: 0download
Bạn đang xem trước 20 trang nội dung tài liệu Điều hòa sự biểu hiện của gen, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ĐIỀU HÒA SỰ BIỂU HIỆN CỦA GENdnthCHƯƠNG VIISự biểu hiện của genTrong một cơ thể đa bàoTế bào được biểu hiện bởi các gen khác nhauMọi tế bào đều có cùng bản chất di truyền DNABiểu hiện gen cần phải được điều hòaỞ những giai đoạn khác nhau trong chu trình sống, những gen khác nhau sẽ được “mở” hoặc “đóng”10 tuần14 tuần1 ngày6 tháng12 tháng18 thángNỘI DUNGCÁC HIỆN TƯỢNG ĐIỀU HÒACÁC MỨC ĐIỀU HÒAĐIỀU HÒA Ở PROKARYOTEĐIỀU HÒA Ở EUKARYOTESỰ BIỆT HÓA TẾ BÀO12345I. CÁC HIỆN TƯỢNG ĐIỀU HÒAĐiều hòa gen nhằm mục đíchGiúp cơ thể thích nghi với những thay đổi về dinh dưỡngĐáp ứng với stressĐáp ứng với các tín hiệu tăng trưởngBiệt hóa tế bào trong quá trình phát triểnKiểm soát chu trình tế bàoĐiều hòa thích nghiLà sự thay đổi hình thái và sinh lý để đáp ứng với các điều kiện môi trường khác nhau.Sự thay đổi này mang tính thuận nghịch.Không làm thay đổi bản chất di truyền.Một số gen hoạt động trong điều kiện này và một số gen khác ngừng hoạt động.Ví dụ: - Amip trong môi trường nước sẽ hình thành các chân giả (pseudopod) để bơi. - Vi khuẩn sống trong môi trường dinh dưỡng tối thiểu sẽ có khả năng tổng hợp các acid amin cần thiết.Điều hòa thích nghiAmipHoạt động nối tiếp của các genSự biểu hiện của gen trong cơ thể được lập trình nối tiếp nhau trong quá trình phát triển. Ví dụ:- Trong quá trình phage nhiễm vào vi khuẩn, gen “sớm” tạo enzyme sao chép DNA, gen “muộn” tạo các thành phần vỏ.Biệt hóa tế bàoTrong cơ thể có rất nhiều loại tế bào xuất phát từ hợp tử ban đầu.Mỗi loại tế bào chỉ biểu hiện một phần thông tin di truyền - sự biệt hóa (differenciation).Sự biệt hóa không làm thay đổi bản chất di truyền.Biệt hóa tế bàoBiểu hiện gen ở Prokaryote và EukaryoteBiểu hiện gen ở ProkaryoteSố lượng gen giới hạn chứa trong một phân tử DNA vòng tròn.Quá trình phiên mã xảy ra trực tiếp trong tế bào chất.Chu trình tế bào ngắn.Không có sự biệt hóa tế bào.Hoạt động của gen được điều hòa theo nhu cầu tế bào.Eukaryote là cơ thể đa bào.Cấu trúc nhiễm sắc thể phức tạp.Có sự biệt hóa tế bàoCó quá trình phát triển cá thể qua nhiều giai đoạn nối tiếp nhau.Sự điều hòa biểu hiện gen phức tạp qua nhiều mức độ, nhiều giai đoạn.Biểu hiện gen ở EukaryoteBiểu hiện gen ở EukaryoteII. CÁC MỨC ĐIỀU HÒAẢnh hưởng trực tiếp đến việc mở hoặc đóng genXảy ra ở quá trình điều hòa trao đổi chất và quá trình biệt hóa tế bàoĐiều hoà phiên mãĐiều hòa dươngĐiều hòa âmTrình tự điều hòaKhông phiên mãPhiên mãChất kích hoạtChất ức chếPhiên mãKhông phiên mãĐiều hoà phiên mãĐiều hòa sau phiên mãTốc độ chế biến mRNA có thể làm tăng hoặc giảm sự biểu hiện của genCác protein vừa được tổng hợp phải được chế biến trước khi biểu hiện hoạt tính.Ví dụ: insulin chỉ hoạt động khi được cuộn lại, tạo liên kết đồng hóa trị và cắt rời.Điều hoà hoạt tính proteinIII. ĐIỀU HÒA Ở PROKARYOTE Có 5 mức điều hòa ở Prokaryote Điều hòa phiên mã quan trọng nhấtCác mức điều hoà ở ProkaryoteLà một đơn vị phiên mã, bao gồm một nhóm gen được điều hòaCấu trúc của một operon gồm:Gen cấu trúc mã hóa cho các enzymeGen khởi động (promoter)Gen chỉ huy (operator)Gen điều hòa nằm về phía trước của operon, mã hóa cho chất kìm hãm (repressor)OperonTổ chức của operon vi khuẩnCấu trúc của một operonOperon ở trạng thái được cảm ứngCấu trúc của một operonOperon ở trạng thái bị kìm hãmCấu trúc của một operonBiến dưỡng (anabolism): tổng hợp các chất cần thiết cho tế bào (vd: acid amin) Ví dụ: Quá trình tổng hợp tryptophanBắt đầu từ tiền chất là acid chorismicCó 5 enzyme xúc tác quá trình tổng hợp tryptophan Sự tổng hợp các enzyme này do 5 gen nằm kề nhau điều khiển Kiểm tra biến dưỡngGen cấu trúcCác enzym xúc tác quá trình sinh tổng hợp tryptophanOperon TryptophanLà một protein gắn với operatorKhi gắn vào, sự phiên mã bị chặn lạiĐược phiên mã từ một vị trí khác của bộ genPhải được hoạt hóa để trở thành dạng có chức năngChất kìm hãm TrpHoạt động của chất kìm hãm TrpThoái dưỡng (catabolism): phân hủy thức ăn để tạo năng lượng hay các chất cần thiết cho tế bàoVí dụ: Quá trình phân hủy lactose để tạo glucose - Tế bào E.coli có 3 gen cấu trúc tổng hợp 3 enzyme xúc tác cho quá trình là -galactosidase, permease và transacetylaseKiểm tra thoái dưỡngCon đường trao đổi chất của LactoselacZ : b-galactosidaselacY : lactose (galactoside) permeaselacA : galactoside transacetylaseOperon LacLactose (-)Lactose (+)IV. ĐIỀU HÒA Ở EUKARYOTEĐiều hòa gen eukaryoteQuá trình điều hòa sự biểu hiện gen ở eukaryote rất phức tạp, qua nhiều mứcĐiều hòa sự đóng gói DNATế bào có thể dùng sự đóng gói DNA để bất hoạt gen trong thời gian dài.Vd: sự bất hoạt NST X (thể Barr)Thường thấy ở cá thể cái động vật có vúCó liên quan đến 1 NST X bị bất hoạt trong NST củatế bào somaĐuôi histone DNA double helixNucleosome (a) Đuôi histone nhô ra khỏi cấu trúc nucleosomeHistone chưa acetil hóaHistone acetyl hóa(b)Quá trình acetyl hóa histone làm cho cấu trúc chromatin lỏng lẽo, cho phép sự phiên mã xảy raBiến đổi histoneBiến đổi histoneSự methyl hóa DNAGắn nhóm methyl (- CH3) vào một vài base trên DNA để làm giảm sự phiên mã DNACó thể gây bất hoạt gen lâu dài, ảnh hưởng trong sự biệt hóa tế bàoPhiên mã gen eukaryoteĐiều hòa phiên mã có liên quan đến các trình tự DNA ngắn và các protein điều hòaCác chuỗi trình tự DNA ngắnTham gia vào quá trình điều hòa biểu hiện genDài khoảng 20 cặp base, nằm ở vùng lân cận promoter của gen cấu trúcLàm điểm nhận biết cho việc gắn các protein điều hòaCó cấu trúc gồm 2 phần đối xứng nhauVd: 5’ AATTGTGAGCGGATAACAATT3’ TTAACACTCGCCTATTGTTAATranscription factorsCác chuỗi trình tự DNA ngắnCác protein điều hòa genGắn vào các trình tự DNA chuyên biệt để hoạt hóa hay ức chế sự phiên mã của gen.Chứa các vùng cấu trúc (motif) có thể đọc các trình tự nhận biết đặc hiệu và tạo các liên kết yếu với chúng.Có 4 kiểu motif:Helix – turn – helix (xoắn – vòng – xoắn)Helix – loop – helix (xoắn – móc – xoắn)Zinc finger (ngón tay kẽm)Leucine zipper (khóa dây kéo leucine)Các kiểu tương tác DNA - proteinĐiều hòa sau phiên mãCác intron được cắt khỏi tiền mRNA để tạo các mRNA trưởng thành sẵn sàng cho dịch mã.Quá trình cắt “khác biệt” (Alternative splicing) sẽ cắt tại các vị trí khác nhau trên gen ở các loại mô khác nhau.mRNAs trưởng thành trong mỗi loại mô sẽ có các exon khác nhau, cho ra các sản phẩm polypeptide khác nhau từ đoạn gen giống nhau.Điều hòa sau phiên mãNhững đoạn intron của mRNA Eukaryote có liên quan đến thời gian tồn tại (1/2 life) và việc ra khỏi tế bào chất của mRNA. Ảnh hưởng đến sự trưởng thành của mRNA. Các mRNA có thời gian tồn tại trong tế bào chất ngắn thì được có thể được dịch mã ít.Điều hòa sau phiên mãProtein được tạo ra và được phân hủy liên tục trong tế bàoSự phân hủy protein có liên quan đến việc gắn với UbiquitinXảy ra ở cấu trúc ProteasomeSự phân hủy protein trong tế bàoSự phân hủy protein trong tế bàoV. SỰ BIỆT HÓA TẾ BÀOSự biệt hóa tế bào là sự biểu hiện một vài gen nào đó trong tế bào, nhằm giúp tế bào đảm nhận những chức năng chuyên biệtChỉ có ở cơ thể đa bàoCác tế bào biệt hóa đều chứa cùng lượng thông tin di truyền như nhauĐịnh nghĩaHợp tửTúi phôiPhôi vịCơ timCơ xươngTb ống thậnTb tuyến giápTb tuyến tụyLá phôi giữaLá phôi trongLá phôi ngoàiTb mầmCopyright © 2007 Pearson Education Inc., publishing as Pearson Benjamin CummingsCác tế bào biệt hóa chứa thông tin như nhau.Các tế bào chỉ sử dụng một phần thông tin di truyền.Có sự hoạt động nối tiếp của các gen trong quá trình phát triển phôi.Sự điều hòa phiên mã là nền tảng của sự biệt hóa tế bào.Các đặc trưngCác tế bào biệt hóa chứa thông tin như nhauSố lượng DNA của các tế bào biệt hóa giống như của hợp tử ban đầuTế bào biệt hóa chứa thông tin di truyền đủ để phát triển thành các thể nguyên vẹnNòng nọcCác tế bào biệt hóa chứa thông tin như nhauCấy phôi vào “mẹ nuôi”Tế bào biểu bì từ vòi trứngCác tế bào biệt hóa chứa thông tin như nhauTế bào chỉ sử dụng một phần thông tin di truyền Các tế bào ở các mô khác nhau có hàm lượng protein và RNA khác nhau. Nhiều tế bào chuyên hóa chỉ tổng hợp chủ yếu 1 loại protein. Vd: - Tế bào cơ tổng hợp nhiều myosin- Tế bào biểu bì tổng hợp nhiều keratinCác gen hoạt động nối tiếp trong sự phát triển phôiCác trạng thái biệt hóa của tế bào có được là do hoạt động nối tiếp của các gen khác nhauVí dụ: chỗ phình (puff) trên nhiễm sắc thể khổng lồNhiễm sắc thể khổng lồ (polytene chromosome)Hiện tượng nhiễm sắc thể khổng lồ có ở tuyến nước bọt của ấu trùng sâu bọNhiễm sắc thể nhân đôi nhưng không tách ra Nhiễm sắc thể khổng lồ ở ruồi dấmChỗ phình (puff) trên nhiễm sắc thể khổng lồXảy ra khi DNA của một phần NST khổng lồ được nới lỏng ra cho phép phiên mã.Chủ yếu được cấu tạo từ RNA (được tổng hợp do gen của vùng tạo chỗ phình)Sự phình ra (puffing) được kiểm soát bởi hormon tăng trưởng ecdysone Chỗ phình (puff) trên nhiễm sắc thể khổng lồ Có sự tương quan giữa sự tạo thành chỗ phình với các giai đoạn phát triển của côn trùng Ở mỗi giai đoạn phát triển, một số gen mở ra và một số gen đóng Ví dụ: giai đoạn lột xác và hóa nhộng của côn trùngChỗ phình (puff) trên nhiễm sắc thể khổng lồSự phát triển từ giai đoạn trứng đến giai đoạn trưởng thành của DrosophylaNhững điều cần nhớMục đích của quá trình điều hòa sự biểu hiện của genCác kiểu điều hòa: thích nghi, nối tiếp, biệt hóaĐiều hòa âm, dươngOperon, promoterKiểm tra biến dưỡng, thoái dưỡngBiệt hóa tế bào

Các file đính kèm theo tài liệu này:

  • pptxchvii_dieuhoabieuhiengen_5313.pptx
Tài liệu liên quan